circad | circRNAs associated with diseases

hsa-circ-000595
Gene	BTBD7	Organism	Human
Genome Locus	chr14:93753822:93762503:n/a	Build	hg19
Disease	Aortic aneurysm	ICD-10	Acute myocardial infarction (I21)
DBLink	Link to database	PMID	26324352
Experimental Method
Sample Type	Aortic Tissues	Comparison	aortic aneurysm and normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACGCGGCCTAAATATGAGCA Reverse GAAGCTTCCAGACTGAGCCAC	Statistics	Fold Change : Upregulated, 1.5fold pvalue : p<0.05
Citation
Zheng, C, Niu, H, Li, M, Zhang, H, Yang, Z, Tian, L, Wu, Z, Li, D, Chen, X (2015). Cyclic RNA hsa"�circ"�000595 regulates apoptosis of aortic smooth muscle cells. Mol Med Rep, 12, 5:6656-62.